                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggcgatccgaagattccggacgcgatctgtggggatacgggcgatcacaccaacagcctctacagcatcagcgcgcggccctaaccaggctaccgcccc
acgccatgagtctccaaagacttcagattggatgactcagcgctgatcgacaaacgccacagccaacctgttggccgatcgatccaagtgcgcgcctgac
cgcgcacgtaggtcagaatttcgctgctagcctcactagcactactttggcagattgttgattttgccgcgttttataggattcccgaatcaatttttca
ATG

    bll1647 Gene: bll1647     GI: 27376758     BI number: bll1647     GOG: COG5659     Description: tg c  a c  c gc cg         t gc       c  c cg       c  a gc        gc ta        at gc        ta a  g       cg a  t       gc c  a       ta cg       c  c tg       g  t at       c  a       tt gc       t  c      g  g |  a      t  |      t  a cg       t  |      t  t ta       a  |       at |  a       at        gt |  t       gt        at |  t       at        cg at        cg        gc gc        tg        gc cg        gc        tg                         cgttttataggattcccgaatcaatttttcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG5659 FOG: Transposase ... can be seen here     ..................................................................................................................