Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggccgcaggggaaagctttccccataaaggcacgtagtttcaaggaagcgtcattctcctttggttagtcgcggtgtattgtcagaagcaaacaactggg
ggctaaatgcgtggaaggtgaagcagagccggcagattcgccggaggcatttcttacgacattgggagaaagcctgaagcaaagagaaggtgtcgatgcc
ggcctagcggagatcctgaagacgtacatcctgaaggcggcgcccgctcagaaccccgtcgctcaggccaaggatgccatcctgaaactcgcaggcgaac
GTG

    bll1930 --- bll1929


Gene: bll1930     GI: 27377041     BI number: bll1930     GOG: -------     Description: -
Gene: bll1929     GI: 27377040     BI number: bll1929     GOG: -------     Description:


  g
a  a
c  a
 tg
 gc
 ta
 ta
a  a
t  c
g  a       ag
 ta       a  g
 gc       g  t
 gt       g  g
 cg       t  a
g  g      g  a
 cg        cg
 tg        gc        at
|  g       ta       g  t
 gc       a  g      a  c
 at       a  |       cg
 ta       a  |       gc
 ta        ta        gc
|  a       cg        cg
g  t       gc        cg
g  g       gc       g  a
t  c      g  g      a  g
t  g      g  g      g  |
t  t       gc       a  |
 cg        ta        cg
 cg        cg        gc
                        atttcttacgacattgggagaaagcctgaagcaaagagaaggtgtcgatgccggcctagcggagatcctgaagacgtacatcctgaaggcggcgcccgctcagaaccccgtcgctcaggccaaggatgccatcctgaaactcgcaggcgaacGTG


    ..................................................................................................................