                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-21.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.25 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACCACCGCCGGGCTTGGCAGCGTACCGCTTTCACCCAACAGCACGACCGTACAGACC
GTTAGCCTTGGCGTGAACTACAAGCTGCCGATACTTGGAGCGAGGTAAgagtcgggagatactg
acgcaagaaggctcggcctcacggctgggccttcttgtttgctggccgacgctccggcacgacgagttctccgagcagccgcacgcgcaattccctcagt
tgtttcgtcctgttggcgaatgctttcaactccgcatcaacgtcctgtcgtttgcgcatcttcggtctccatcgattgATG

    bll1943 Gene: bll1943     GI: 27377054     BI number: bll1943     GOG: COG0507     Description:   A T  C AT GT CG CG G  |       tg TA       c  a CG       a  c GC       t  g |  G      a  c A  A      g  a A  G      a  a CG       g  g AT       g  a       ca TA       g  a      t  c C  A       cg        cg A  g       tg        cg A  a       gc        gc G  |       at        gt T  |       gc        cg G  |      A  g       tg Cg       A  |       cg Gt        Tg        gc Gc        Gc        gc Tg        Gc        at Tg        At        at Cg        Gc        gc                         ttgtttgctggccgacgctccggcacgacgagttctccgagcagccgcacgcgcaattccctcagttgtttcgtcctgttggcgaatgctttcaactccgcatcaacgtcctgtcgtttgcgcatcttcggtctccatcgattgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0507 ATP-dependent exoDNAse (exonuclease V), alpha subunit - helicase superfamily I member ... can be seen here     ..................................................................................................................