Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=24 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCAAGCACcttgaaatcggccgacttcaggaacgacgacgcaaggtcacattttcttcgaaaaccgcgtgctaactgtcgcctggttgtcg
cagccggatgtacgccgtggcatcacgtggccccggctttcatgccggggtttttcgttttcggcgcgagaagcccgatttaagatttaagatgtctttt
tgtgcagcttgatttcggatcatgacgcgtcgcagcccactgcgacaattctgcttggatcagcaggaacgtcccgggcaaggcgaaaagccgaatagca
ggcagacATG

    bll1946


Gene: bll1946     GI: 27377057     BI number: bll1946     GOG: -------     Description:


  c
t  g
 gc
 ta
 tg
 gc
 gc
 tg
 cg
c  a
 gt
 cg
|  t
 ta
 gc
t  |
c  |       ac
a  |      c  g
a  |      t  t       tc
t  |      a  g      t  a
 cg        cg       t  t
 gc        gc        cg
t  |       gc        gc
 gc       t  c       gc
 cg        gc        cg
 gt        cg        cg
 cg        cg        cg
 cg        gc        cg
                        tttttcgttttcggcgcgagaagcccgatttaagatttaagatgtctttttgtgcagcttgatttcggatcatgacgcgtcgcagcccactgcgacaattctgcttggatcagcaggaacgtcccgggcaaggcgaaaagccgaatagcaggcagacATG
    ..................................................................................................................