Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggacagcagttgtacagctaagaaagcgttcctttgtcggacttctgacaacgtcggatacgcctcggcgtagtgctgtgtcagatcctcagattccgg
aacgccaccgacaggctatcgctgcgatgctcgcgcggcatcgagcgcccacgaacccgaaatcgagagcaatgacaggatgctcgcggattgtctcgag
cggttcggtgttgctgcgtaagcggtgtgtctcccacaccttgtttggcgtgagctgaccggcaacatgcgagccgtcatatacagtaaggttcgcatat
ATG

    bll2139


Gene: bll2139     GI: 27377250     BI number: bll2139     GOG: COG2963     Description:


  c
a  a
g  g
t  g
a  a
 at
 cg
 gc
 at         c
 gc       t  g
a  g      c  a
g  |       tg
c  |       gc
t  |       tg
a  |       tg        ta
a  |       at       g  a
a  |       gt        cg
 gc        gc        gc
 cg        cg        tg
 cg       g  |       cg
c  a      c  |       gt
a  |      t  |       tg
 at        cg       |  t
 gt        gt       |  g
 cg        tg       |  t
 at        at       |  c
c  |       gt       |  t
c  |      |  g      |  c
c  |       gc       |  c
g  |       at       |  c
c  |       cg        ta
 gc       a  |       gc
 at        gc        ta
 gc        tg        gc
 cg        at        gc
                        ttgtttggcgtgagctgaccggcaacatgcgagccgtcatatacagtaaggttcgcatatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG2963 Transposase and inactivated derivatives ... can be seen here

    ..................................................................................................................