Gene putatively regulated by attenuation in B_japonicum
Characteristics of the secondary structures
Terminator: Distance to gene:134 nt. Distance to run of Ts=1 nt. Size=28 nt. Delta G= -7.80 kcal/mol
Antiterminator: Size=46 nt. Delta G= -6.06 kcal/mol
Anti-antiterminator: Size=50 nt. Delta G=-18.20 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CCAtttcaaacctgaattcaatgatttagtcgctggcttcccctgtaatgtgccccaaaaaagcgggggcacaataggggcacatcggctcctacctt
ggtcagtcgtttccgagaagccaaccatccaagagcagacggcaggcgcgttattgccgagcatgttttcgtaaagagcatgcgatgctgctctagactt
gcgagcaacagcgacgacgcgcgtgaaggctttggtctagtccgcagcgcatgaaagcgccgctcgcgatcatcgcggattcgatggcaattcccgccga
acATG
bll2187 --- bll2186
Gene: bll2187 GI: 27377298 BI number: bll2187 GOG: NOG43667 Description: -
Gene: bll2186 GI: 27377297 BI number: bll2186 GOG: ------- Description:
at
c c
a g
cg
gc ac
gt a c
gc c a
gc c t
at g c
ta a c
| c a a
| c g a
at a g cg
at g a g t
cg c g c t
a | c c g a
cg ta gt
gt tg at
gc ta cg
| a gc gc
g g cg gc
gt tg cg
gc gc a a
cg a a g |
gt cg a |
at tg cg
at gc gc
atgttttcgtaaagagcatgcgatgctgctctagacttgcgagcaacagcgacgacgcgcgtgaaggctttggtctagtccgcagcgcatgaaagcgccgctcgcgatcatcgcggattcgatggcaattcccgccgaacATG
..................................................................................................................