                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-23.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGTCTTCATCTGCAAGCTCCGCAAGAAGCTCGCCAACGCCTCCGAAGGCCGCAACT
TCATCGAGACCGTGTGGGGCCGCGGCTACGTGCTGCGCGAGCCGCACGAGCACGAAGA
GCGCATTCCCGCCTGAtcctgggtttacgtcgcgagccgcagggctcgctcctcccagcctggaccccgccgcaaatggcggggtttt
gttttttggggacgctaacgcggcttcgtcgccgtcccgccgttgaaccgctatcctccccccgccgacgaatggtcgctgcacgatgggggaacgATG

    bll2199 Gene: bll2199     GI: 27377310     BI number: bll2199     GOG: COG3766     Description: ca g  g cg cg gc at gc cg gc c  t t  c g  c c  t a  | t  | t  | t  | gc gc gc ta cg c  c t  c       aa A  t      c  a G  |       gt T  |       cg Cg        cg Cg        gc G  a       cg C  c       cg C  c       cg C  c       cg T  c       at T  g       gt A  c       gt C  |      t  t Gc       c  | Cg        cg Gc        gt             tttttggggacgctaacgcggcttcgtcgccgtcccgccgttgaaccgctatcctccccccgccgacgaatggtcgctgcacgatgggggaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3766 Predicted membrane protein ... can be seen here     ..................................................................................................................