Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGGCGGCCGCGAGCAGCGGCACTATCAATTTCGTCCTTGATCCGTTCATGTGCAC
CTCCCTTTGGTCGCCCCGCATcaggcgacttcacggcgctttttgcgccttattttattcacacagcgaagaaatgtcgcagagc
aaaacagaaaaatcaggatgcacttgctcactcttcgagtttagatagtacatggggtattataatagtaaatatgacgcataacgactccctttggctg
tgctttttcaacaacactaccgagacacgcacctattaaattcactaacagaattaaATG

    bll2268


Gene: bll2268     GI: 27377379     BI number: bll2268     GOG: COG1940     Description:


 CG
T  T
T  C
T  C
 AT
 AT
 CG
 TA
 AT
T  |
C  |
A  |
C  |
 GC
 GC
 CG                  CA
 GT                 G  T
 AT                 C  c
|  C                C  a
C  A                 Cg
G  T                 Cg
A  G        C        Gc
 GT       C  T       Cg
 CG       C  T       Ta
 GC       T  T       Gc
C  A       CG        Gt
C  |       CG       T  t
 GC        AT       T  c
 GC       C  |      T  a
C  T       GC       C  c
 GC        TG        Cg
 GC        GC        Cg
                        cgctttttgcgccttattttattcacacagcgaagaaatgtcgcagagcaaaacagaaaaatcaggatgcacttgctcactcttcgagtttagatagtacatggggtattataatagtaaatatgacgcataacgactccctttggctgtgctttttcaacaacactaccgagacacgcacctattaaattcactaacagaattaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[KG] COG1940 Transcriptional regulator/sugar kinase ... can be seen here

    ..................................................................................................................