                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:99 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-23.00 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=41 nt.     Delta G=-11.21 kcal/mol
Anti-antiterminator:    Distance from promoter:18 nt.    Size=40 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggata-tacaat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggatagaggccctttacctcagtacaattgagtagggaacgcgcgcgccttagcctggctgcattcggcgccctggcgctagtggcattggatcctccc
taacctgggcgcaagacggccgcccctgtccggtcgtctgcgctgctttttcggcaagccatcggtgccttcattgttcttccggccgacacaccgcgcc
ctggcggtgggatcggccgcctttcgcgtgcaactggagatttacgcagaATG

    bll2335 Gene: bll2335     GI: 27377446     BI number: bll2335     GOG: COG1432     Description:   t t  c a  g       ac cg       a  c gc       t  t       ct t  |       cg       c  g cg        cg       c  t gc        cg       c  c gc       t  c       gc |  c      c  g       cg |  t      c  c       cg tg       t  a       gt cg       a  a       gc |  c      g  g       cg cg       g  a       at gc       t  c       gc at       t  g      a  | ta       a  |       at tg        cg        cg |  t       gc        gc cg        gc        cg cg        tg        gc gc        gc        gt                         gctttttcggcaagccatcggtgccttcattgttcttccggccgacacaccgcgccctggcggtgggatcggccgcctttcgcgtgcaactggagatttacgcagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1432 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................