                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-10.21 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-11.91 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCTGCCGGGCAGCAGGCGACGCCATTTCAGAAGACGGAGGCGACGCTCGCCCCAG
TCATGGAGAGAGCCGTCGAGGGCCGGCCGGCCGAAGACCGTTCGCCGCAGGCCGTTCC
GGCCGCCTGAgatcgcatatcccggcaacagcttgccgcggctctgttttctccggtcgccggtttgaacctgttcctgatacagtgcaccaa
tgtctaagagtgattccggtcacacttgcctgggcgctcctctgctaagcatcgaaccaggacgggaccggtagagcatcggtagaattgaATG

    bll2339 --- bll2338 Gene: bll2339     GI: 27377450     BI number: bll2339     GOG: -------     Description: - Gene: bll2338     GI: 27377449     BI number: bll2338     GOG: COG2114     Description:            CC           T  G            TG            GC           C  C            CG        ag   C        GC       c  c A  C       GC        at G  G       AT        at AT        CG        cg AT       |  A       gc GC       |  g       gc CG       |  a      c  | |  C      |  t      c  | |  C      |  c      c  | CG       |  g      t  | GC       |  c      a  | G  A      |  a      t  | CG       |  t      a  | CG       |  a       cg GC       |  t       gc GC       |  c       cg CG       |  c       tg C  T       Gc       a  | G  T       Cg        gc GC        Cg        At GC        Gc        Gc                         tgttttctccggtcgccggtttgaacctgttcctgatacagtgcaccaatgtctaagagtgattccggtcacacttgcctgggcgctcctctgctaagcatcgaaccaggacgggaccggtagagcatcggtagaattgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2114 Adenylate cyclase, family 3 (some proteins contain HAMP domain) ... can be seen here     ..................................................................................................................