                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctacccgcccccaatcgacaggcgcgaggagatggtccctggaccattccctcgcgcctttgtcttgaccatggcgtttgcctaagaatcgtgcttaagg
catgcgaccttgatgcaatcatttgctgaatctgcgtctgatcgcagcagcagcttcgttgatgttgaatcgcggtgcggaggatggcaattcggtccgc
gctgggttatattttgcgccgcacaagaatttgacatagttttgggccatcaaggacctacggtctaaatcgatacgccatccatagttcgcaacgagat
ATG

    bll2363 --- bll2362 --- bll2361 Gene: bll2363     GI: 27377474     BI number: bll2363     GOG: -------     Description: - Gene: bll2362     GI: 27377473     BI number: bll2362     GOG: COG0489,COG3206     Description: succinoglycan biosynthesis transport protein Gene: bll2361     GI: 27377472     BI number: bll2361     GOG: -------     Description:                      gc            cg       g  a           t  t       ta           t  t       at           c  g       gt tg       g  a       gc c  a       at       |  g t  t       cg       |  g gc        gt        at cg        at        gc gc        cg        gc ta       |  a       cg cg       |  a       gc t  c      g  t       tg a  a      a  c       gc a  g       cg        gt gc        gc        cg ta        cg       g  | cg        tg        cg gc        at        tg                         ttatattttgcgccgcacaagaatttgacatagttttgggccatcaaggacctacggtctaaatcgatacgccatccatagttcgcaacgagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0489 ATPases involved in chromosome partitioning ... can be seen here [M] COG3206 Uncharacterized protein involved in exopolysaccharide biosynthesis ... can be seen here     ..................................................................................................................