                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGCGGCATCGGCGAGCATGCCAGCGAGATCCGCAGCGCGATCGGCGAGCGTCTCGC
CTGGCTCGGCGTGCGCATCGATGCAGCGGCGAATAGCGAGGGACGCGAGCGGATCGGC
ACCGGCGACAGTGCGGTCGATATTTTCATCATTCCCACCAACGAAGAGATCGCGATCG
CGCGCCATTGCGCCGCGCTTCTGCGCGAACGACACGCTGCGTGAcggttttatgaatgatctgtcgc
aatgaggccgtcgcaacttcgcggcataaggacggcatcaaccgttgcgcggacagaccATG

    bll2516 --- bll2515 --- bll2514 --- bll2513 Gene: bll2516     GI: 27377627     BI number: bll2516     GOG: -------     Description: - Gene: bll2515     GI: 27377626     BI number: bll2515     GOG: COG0574     Description: - Gene: bll2514     GI: 27377625     BI number: bll2514     GOG: -------     Description: - Gene: bll2513     GI: 27377624     BI number: bll2513     GOG: COG0463     Description: CA C  C C  C                 TC T  A                T  T T  A                 CG A  C                 GC CG                  CG TA        CA        GC A  A      C  T       CG CG        GT       |  A TA        CG       |  A TG        GC       |  C TA        CG       |  G T  T       GC       |  A A  C      C  |      |  C T  G      T  |      |  A A  |      A  |      |  C GC        GC       |  G CG        CG       |  C TA        GC       |  T GT        CG        CG GC       |  C       GC CG       T  T       CG GC        AT        GT TG        GC        TG GC        AT        TA                         cggttttatgaatgatctgtcgcaatgaggccgtcgcaacttcgcggcataaggacggcatcaaccgttgcgcggacagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0574 Phosphoenolpyruvate synthase/pyruvate phosphate dikinase ... can be seen here [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_japonicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:158 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.00 kcal/mol Antiterminator: Size=46 nt.     Delta G= -9.60 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-19.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGGCGGCATCGGCGAGCATGCCAGCGAGATCCGCAGCGCGATCGGCGAGCGTCTCGC CTGGCTCGGCGTGCGCATCGATGCAGCGGCGAATAGCGAGGGACGCGAGCGGATCGGC ACCGGCGACAGTGCGGTCGATATTTTCATCATTCCCACCAACGAAGAGATCGCGATCG CGCGCCATTGCGCCGCGCTTCTGCGCGAACGACACGCTGCGTGAcggttttatgaatgatctgtcgc aatgaggccgtcgcaacttcgcggcataaggacggcatcaaccgttgcgcggacagaccATG     bll2516 --- bll2515 --- bll2514 --- bll2513 Gene: bll2516     GI: 27377627     BI number: bll2516     GOG: -------     Description: - Gene: bll2515     GI: 27377626     BI number: bll2515     GOG: COG0574     Description: - Gene: bll2514     GI: 27377625     BI number: bll2514     GOG: -------     Description: - Gene: bll2513     GI: 27377624     BI number: bll2513     GOG: COG0463     Description: CG T  A        G AT       G  G CG       A  A GC        GC C  A       CG G  |       GC TG       A  G GC       T  A CG       A  G G  G      A  | GC        GC CG        CG        CG TA       G  G      G  A C  A      G  A      G  C G  |      C  T      C  A GT       G  C       CG TA       A  G       AT C  |       CG        CG CG        GC       G  | GC        TA        GC CG       A  C       CG TA        GC        TG CG        CG        AT TG        TG        GC                         GATATTTTCATCATTCCCACCAACGAAGAGATCGCGATCGCGCGCCATTGCGCCGCGCTTCTGCGCGAACGACACGCTGCGTGAcggttttatgaatgatctgtcgcaatgaggccgtcgcaacttcgcggcataaggacggcatcaaccgttgcgcggacagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0574 Phosphoenolpyruvate synthase/pyruvate phosphate dikinase ... can be seen here [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here     ..................................................................................................................