                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCGAGGAAGGAGATGACCTCTTCCTCCTTGCGCGCATCGAGCGAGCGCGCGTGGAT
TTCGCCACCGGCCGCCTCGATGTCCTTCACCAGCGGCGCGAGCTTGTCGCCGTTGCGG
CGGCCGGCGAAGATCGAAAAACCTTCGGCGGCGAATTTCTTCGCGATTTCGGAGCCGA
TGAAATCGCCGGCCCCGATGACGGCAGCTGTCGCGTTTCGCTTGGACAAggtcgcctcctccgg
tgcggatatgtctggagcaaaggctatagttctaaaatagaactgtcaaattgcgaggcagaATG

    bll2604 Gene: bll2604     GI: 27377715     BI number: bll2604     GOG: COG1733     Description: transcriptional regulatory protei             T           T  G            GC            CG            CG            GC            CG        AA            TG       G  A GC        GC       C  A A  T      T  C      T  A GT        TG       A  C CG        CG        GC |  T       GC        AT GC       A  G       AT CG       G  A       GC GC       C  A       CG GC       G  G      G  G CG       C  A       GC GT        GT        CG AT        GC        CG CG        CG        GC                         GAATTTCTTCGCGATTTCGGAGCCGATGAAATCGCCGGCCCCGATGACGGCAGCTGTCGCGTTTCGCTTGGACAAggtcgcctcctccggtgcggatatgtctggagcaaaggctatagttctaaaatagaactgtcaaattgcgaggcagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1733 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................