                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-30.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attccggggcggctcgaagagccgaccccggaatgacagtaccggacacgcaccccgcccacttgtccggcgtgatttccatgctaggctggccgcacag
atggggatggagtcccccgacaaccgcccggcggtaggtgaccgtgatgggctgatgactcctgcttgaggtggggcaatttttgagcctctgcctttgg
cgggagcgtggacaaacccgccaatggcgggttttttgttgcctgaaggcgaaggccgggacgtgaaggccaaggggacgttcgaggggaagtccaaggc
GTG

    bll2640 --- bll2639 --- bll2638 --- bll2637 Gene: bll2640     GI: 27377751     BI number: bll2640     GOG: COG0477     Description: major facilitator superfamily transporter Gene: bll2639     GI: 27377750     BI number: bll2639     GOG: COG0239     Description: - Gene: bll2638     GI: 27377749     BI number: bll2638     GOG: COG0239     Description: - Gene: bll2637     GI: 27377748     BI number: bll2637     GOG: COG1993     Description:   t t  t t  t a  g a  a cg gc gc |  t gc gt tg gc gc at gt t  t tg cg gc tg cg cg ta cg a  |                  a gc                 a  t tg                  cg at                  cg g  |       aa        gc tg       c  a       cg cg       a  c       cg g  a       gc        cg g  |       gc        at gc        tg        at ta        gc        at                         tttgttgcctgaaggcgaaggccgggacgtgaaggccaaggggacgttcgaggggaagtccaaggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [D] COG0239 Integral membrane protein possibly involved in chromosome condensation ... can be seen here [D] COG0239 Integral membrane protein possibly involved in chromosome condensation ... can be seen here [S] COG1993 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................