                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCAGAGAATGTGCATCTTGGTCTCGGCCAGCGACCACGCCACCGCCGCGCCTGAAG
CGCCGGCGCCGATGATCAGGACGTCCACGGGGTCTTTCATCGCGATCTTTTTCCTCCC
CCTCGCCGCTTCCCGGGCGATTCGGCCTCCGCAGTCCGTGAGGCCGGCACGAACGATA
GGGTCAGAGCGACGGCTGAGTAAAGCCGCGGGGCCGGAATGTCGCACTTCGCAGGGCG
CAGACCATTGGTATCGCCACATccggatgctaggaacgaggcgaaagagcaatcgatagcgagaccgtATG

    bll2718 Gene: bll2718     GI: 27377829     BI number: bll2718     GOG: COG1525     Description:   G T  A C  A CG GC CG |  C GC CG CG GC        AC CG       C  G |  C       CG |  C       TG |  G      G  | |  A       CG |  T       AT |  G       GC |  A       GT |  T       AT C  C      C  | A  A      T  | CG        AT CG        GC |  A       TA GC        AT CG        GC AT        CG             CGATCTTTTTCCTCCCCCTCGCCGCTTCCCGGGCGATTCGGCCTCCGCAGTCCGTGAGGCCGGCACGAACGATAGGGTCAGAGCGACGGCTGAGTAAAGCCGCGGGGCCGGAATGTCGCACTTCGCAGGGCGCAGACCATTGGTATCGCCACATccggatgctaggaacgaggcgaaagagcaatcgatagcgagaccgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1525 Micrococcal nuclease (thermonuclease) homologs ... can be seen here     ..................................................................................................................