                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACGAGAAGTCGAAATGGTCGAAATGCAGGGACACGCCGTGTTTCTTGGCGGCCGC
CTCCAAAACACGCAGGCCCTCCGGCATCACTTCCTTGCCGATGCCGTCGCCGGGGATG
ACCGCGATCCGGTATTGTTTTTTGCTCATcgagaacgtccttggttggtccggcagccgccgtcttttgatcgccctgc
aatgaaccaaagtcgcgggcagtgcaacgctgcactgcaatgttgaccgtggcacggccgaccgcctactgatttcatcgtattcctatcttgcgagtaa
cccccATG

    bll2915 Gene: bll2915     GI: 27378026     BI number: bll2915     GOG: COG1028     Description: hypothetical oxidoreductas GC G  C CG GC         C GC       C  T |  T      T  T       AT T  C      T  G      G  G T  C      C  C      G  A C  A      A  C       GC TA        CG        GC TA        TA       C  | TA        AT        CG GC        CG        GC TA        GC        CG GC        GC        TA C  |       CG       |  T CG       |  T      |  C GC       |  C       GC C  A      |  G       CG A  G      |  C       CG C  G      C  C       GT A  |       TG        TA GC        CG        AT GC        CG        GT GC        CG        CG                         TTTTTTGCTCATcgagaacgtccttggttggtccggcagccgccgtcttttgatcgccctgcaatgaaccaaagtcgcgggcagtgcaacgctgcactgcaatgttgaccgtggcacggccgaccgcctactgatttcatcgtattcctatcttgcgagtaacccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................