                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-23.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-24.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgacgagccagggcgaccgcatctccggcaactggagcgaggccagccgcaacatcttcggcaatctccagggcaccgccggcggcggccagatcgagg
tgttcgtcgaggccaacggcttcgccgccaacctgtcgctgcgcaccaacggcaccaagcagacggtgcagatcagctccaagggcgagatccgcggcgt
caacatcacgatgacgaagggctgacgcccttcccgcgtcgagaggaacacgcccccggttctcgcgagccgggggctttttgctgacattgttgcggat
ATG

    bll2998 Gene: bll2998     GI: 27378109     BI number: bll2998     GOG: NOG27173     Description: ga t  c cg gc gc gc at at gc |  c c  c       cc a  g      c  c gc        gc tg        cg at       a  | gc        cg cg        at        cg a  a       at       t  c cg        gc        cg ta        gt        ta a  g      a  |       tg c  g      g  |       gc a  a      a  |       gc a  a      g  |       cg c  c      c  |       cg ta       t  |       cg gc        gc        cg cg        cg        cg gc        gc        gc                         tttttgctgacattgttgcggatATG     ..................................................................................................................