Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-15.51 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGGCCCGGCGACAACGTCGTGATCCAGTCGTTGCTCGCCCATGCGAGCTTCCACGC
CGGCACGCTGATCTGAggccgacgatcgcggtcgcccggcgatcgtgtgttttgcctgtcgggcgcagcccggatggcgcgaaaggca
atcgcgggcccgcgaatcgatgcggtcgtcccggattaggccgcgcgccacccgggctacggcgctttcacggccatgtgagtcctgatactctgcacgc
cgtcgtggctcggcgggccatgccatcgatcgttgaaccagagctgccgagaggATG

    bll3108


Gene: bll3108     GI: 27378219     BI number: bll3108     GOG: -------     Description:


 CA
C  T
 CG
 GC
 CG
 TA
 CG
 GC
|  T
|  T
|  C
T  C
 TA
 GC
 CG
|  C
|  C       gc
|  G      g  c
|  G      A  g
|  C      G  a
|  A      T  c
|  C       Cg        cg
 TG        Ta       t  c
 GC        At        gc
 AT        Gc        gc
C  |      T  |      |  g
 CG        Cg        cg
 TA        Gc        gc
 AT        Cg        cg
 GC       A  |       ta
T  |       Cg        at
 GT        Gt        gc
 CG        Gc        cg
 TA        Cg        at
                        gtgttttgcctgtcgggcgcagcccggatggcgcgaaaggcaatcgcgggcccgcgaatcgatgcggtcgtcccggattaggccgcgcgccacccgggctacggcgctttcacggccatgtgagtcctgatactctgcacgccgtcgtggctcggcgggccatgccatcgatcgttgaaccagagctgccgagaggATG


    ..................................................................................................................