                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions

CTGTTCGTGATCAAGCCGCTGCGCCGCTCCTTCATCCTGGGCAAGGAAGCCGAGAGCG
CCGCCACCGCGACCGGCGGCGCCAAGACCGAGACGGCGTGAcaagccgcacactttgcacggttgaaaaa
ggggcgcagaatgcgcccctttctttttggccaagtttttttggccgaggccggaggcaccgcaaacgtcaataatgctgtcgcaagatttttcggatcc
gccaaatccagcgcttgacgattggcattatgtataccacacttacctcgtcattcacctagggaggttgcaATG

    bll3148 Gene: bll3148     GI: 27378259     BI number: bll3148     GOG: COG0517     Description:            a          g  a          a  t           cg           gc           cg           gc           gc           gc           gc           at           at           at             ctttttggccaagtttttttggccgaggccggaggcaccgcaaacgtcaataatgctgtcgcaagatttttcggatccgccaaatccagcgcttgacgattggcattatgtataccacacttacctcgtcattcacctagggaggttgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0517 FOG: CBS domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_japonicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.70 kcal/mol Antiterminator: Size=75 nt.     Delta G=-26.60 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G=-16.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGTTCGTGATCAAGCCGCTGCGCCGCTCCTTCATCCTGGGCAAGGAAGCCGAGAGCG CCGCCACCGCGACCGGCGGCGCCAAGACCGAGACGGCGTGAcaagccgcacactttgcacggttgaaaaa ggggcgcagaatgcgcccctttctttttggccaagtttttttggccgaggccggaggcaccgcaaacgtcaataatgctgtcgcaagatttttcggatcc gccaaatccagcgcttgacgattggcattatgtataccacacttacctcgtcattcacctagggaggttgcaATG     bll3148 Gene: bll3148     GI: 27378259     BI number: bll3148     GOG: COG0517     Description:             g           g  t            ct            ag            ca           g  a           t  a           t  |            ta            ca           |  g           |  g           a  g           c  g   G        ac A  A       cg GC        gc CG        ca CG        cg A  C      |  a G  G      |  a A  |      | AT       | CG       | |  A      | |  c      | C  a      | G  a      | Cg       | Gc        g Gc        a Cg        a Gc        c |  a       A |  c       G         a G  a      |        g  a C  c      |        a  t C  t      |         cg At       |         gc Gt       T         cg Cg        G        gc Gc        C        gc |  a      G  |       gc |  c       G        gc Cg        C        at Cg        A        at At        G        at                         ctttttggccaagtttttttggccgaggccggaggcaccgcaaacgtcaataatgctgtcgcaagatttttcggatccgccaaatccagcgcttgacgattggcattatgtataccacacttacctcgtcattcacctagggaggttgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0517 FOG: CBS domain ... can be seen here     ..................................................................................................................