                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-30.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTGCTCAAGCCCTGGCGCAAGGTCGTGGTAGCGAAGTCCACGGTCTGAcgcgcttcaccac
acttcattccgacgggacgcccggcctcatggccgggcgttttcgttttgaggattcggaacccgtgtccgaacggaactgccgattttgtaacgggcaa
gccaagattgggcttgcattctgggatatggtataccaagctttgggccgcgcttgcgacgataagccacaatatttgcgacatcaggtcatcttggcaa
ccggtgtcgaccagacaagcgcgttgggaggttcttgATG

    bll3149 Gene: bll3149     GI: 27378260     BI number: bll3149     GOG: COG0477     Description: ca t  t cg cg gc gc cg cg cg gc cg |  t at gt gt gc cg |  t                 cc |  t                t  g |  t                g  a |  t                 ta |  g                 gc |  a                 cg |  g        a        cg |  g      a  c      |  a |  a       gc       |  a |  t       gc       c  c at        cg       a  t gc       t  t      a  g cg        tg        gc cg        at        gc ta        gc        cg ta        gc        ta                         ttttgtaacgggcaagccaagattgggcttgcattctgggatatggtataccaagctttgggccgcgcttgcgacgataagccacaatatttgcgacatcaggtcatcttggcaaccggtgtcgaccagacaagcgcgttgggaggttcttgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................