                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-22.40 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCATGCCGACCTTGATGGTCTTGGCCTGGGCGCGCGCCACCCAGGGCGCTGCAACA
CTCATCGCACCGGCGCCCATCAGCGCCAGCGTTGAACGGCGGCTGATGCCCGGCGTGC
GGGTTCTCGTCATttttccctccctctgtcgggtcggcgtttccaaatccctgtcggagatcgtctcgtctccgtgttcccaaggatttca
gaggtaggggggtgacgtcaagccaaagatgaattacgagtcagaattcatcaagggaggacatgaggccgcaaccggcccaaaacccgcacaATG

    bll3182 --- bll3181 --- bll3180 Gene: bll3182     GI: 27378293     BI number: bll3182     GOG: COG0318     Description: - Gene: bll3181     GI: 27378292     BI number: bll3181     GOG: COG1309     Description: transcriptional regulatory protein Gene: bll3180     GI: 27378291     BI number: bll3180     GOG: COG2072     Description:            TT           G  G           C  A           G  A           A  C            CG            CG            GC           |  G            CG         G            GC       C  T            AT       G  G            CG        GC AT        TA        CG C  C       AT        CG C  A      C  |       CG CG       C  |       GT GC        CG       T  | CG        GC        AT GC       C  |       GC GC        GC       T  | C  A       GC       C  | C  |       CG        GT A  |       CG        GC CG       A  C       CG GC        CG        GT CG        GT        GC                         ATttttccctccctctgtcgggtcggcgtttccaaatccctgtcggagatcgtctcgtctccgtgttcccaaggatttcagaggtaggggggtgacgtcaagccaaagatgaattacgagtcagaattcatcaagggaggacatgaggccgcaaccggcccaaaacccgcacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here [K] COG1309 Transcriptional regulator ... can be seen here [P] COG2072 Predicted flavoprotein involved in K+ transport ... can be seen here     ..................................................................................................................