                                                                        Gene putatively regulated by attenuation in B_japonicum

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-25.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gccaccgccgccgttcggcccttgacgcaggctgcgcgaaaggggcacacaggacgggcatggtgctcgaggtggcgcaaagcgccggagcataatcggg
aatggggatgggcggacccagttgcggcgcccaaaaccccagccgcccccgcgactgtaagcggtgaggggctccgaaccgccactgggccgcaaggtcc
gggaaggccggagaaccccagtgaaccgcgagccaggagaccggccgtgcatgttttgaggccaaggccgtcgggtgtgacggcaggaaaggactgagcc
ATG

    blr3274 Gene: blr3274     GI: 27378385     BI number: blr3274     GOG: NOG25021     Description: ca g  a cg cg gt        aa gc       g  c gc       a  c tg        gc cg        gc |  g      c  a |  a       cg a  a       gt         g cg       g  g      a  a cg       a  a       gc gc       a  a       gc c  |       gc       a  | c  |       gc        cg a  |      |  g       cg a  |       gc        gc gc        cg       a  | cg       c  a       gc cg       t  g       cg ta        gc        gt cg        gc        cg                         catgttttgaggccaaggccgtcgggtgtgacggcaggaaaggactgagccATG                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................