                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.12 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-20.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTCATCGAAATGATGCAGCGCATCGTGGCCGGCAACCCAAGTCGCGACAGCGCCGC
TTCCCTATTCGATTAGaagcggctgctgcgcttttgggtggggctgcttaatttatcatcgtaccgctgcacgaccgtgcaacgtctt
ttgcctcccgcccgcaagcgcgcggaggagatcagcgtctcgcgggcacggtggcgaacccgcgcgtgagttcagggcacgcttgaatttccaatgacaa
tccggcgcaaaccttattgcatccggcatcggcgcacgccctgctccggcggttGTG

    bll3347 --- bll3346 Gene: bll3347     GI: 27378458     BI number: bll3347     GOG: COG1457     Description: - Gene: bll3346     GI: 27378457     BI number: bll3346     GOG: COG2421     Description: gc t  t cg gc g  | cg gc at at Gt At Tg         t T  |      t  a A  |      t  t G  |      a  c C  |      a  a T  |      t  t T  |      t  c A  |       cg T  |       gt C  |       ta C  |      |  c C  |      |  c T  |       cg Tg        gc        ac Cg        gt       g  c Gt       g  g       cg Cg        gc        at Cg        ta        cg G  g       gc        gc Cg       |  g       ta Gc       |  a      c  a At        gc        gc Cg        gc        cg                         tcttttgcctcccgcccgcaagcgcgcggaggagatcagcgtctcgcgggcacggtggcgaacccgcgcgtgagttcagggcacgcttgaatttccaatgacaatccggcgcaaaccttattgcatccggcatcggcgcacgccctgctccggcggttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG1457 Purine-cytosine permease and related proteins ... can be seen here [C] COG2421 Predicted acetamidase/formamidase ... can be seen here     ..................................................................................................................