                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGGATCATTCATCTCGAACAGAGCTGCACAAAAACGCTGTGATTACGCGGCACTGA
ACTGAtcgcacccatcacgcgacacgcgtgcgaatgatcgattgtttccgagtggaaacgaacgcgagacaactttttcactcggcagtttttgccg
aatcacaattcgaacctagcggatttttctattctgtcaggcgcgagatgcgcgatttcgaatcgcacatcgattattttcgccatcgcacgcctgaatt
cgtccgcacgcacgttgatcgcttcgattggcggagaatttcgggATG

    bll3692 Gene: bll3692     GI: 27378803     BI number: bll3692     GOG: COG5610     Description:   t t  c t  t t  a t  t at gc gt                   c cg                 t  g g  t                 ta a  c                 ta ta                  at cg                  gc cg         a        cg a  c      g  t       gc a  g      a  g      c  a gc        gc        gc cg        cg        ta ta        gc        at tg        cg        gc                         gattattttcgccatcgcacgcctgaattcgtccgcacgcacgttgatcgcttcgattggcggagaatttcgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5610 Predicted hydrolase (HAD superfamily) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_japonicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:196 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-10.20 kcal/mol Antiterminator: Size=43 nt.     Delta G=-11.70 kcal/mol Anti-antiterminator:   Size=16 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGCGGATCATTCATCTCGAACAGAGCTGCACAAAAACGCTGTGATTACGCGGCACTGA ACTGAtcgcacccatcacgcgacacgcgtgcgaatgatcgattgtttccgagtggaaacgaacgcgagacaactttttcactcggcagtttttgccg aatcacaattcgaacctagcggatttttctattctgtcaggcgcgagatgcgcgatttcgaatcgcacatcgattattttcgccatcgcacgcctgaatt cgtccgcacgcacgttgatcgcttcgattggcggagaatttcgggATG     bll3692 Gene: bll3692     GI: 27378803     BI number: bll3692     GOG: COG5610     Description:            GA           T  A           C  C        c            AT       a  a            CG        gc           |  A       cg            Gt        gc            Gc        cg            Cg        at            Gc        cg           |  a      t  c           C  c      a  g           A  c      c  a           T  c      c  a            Ta       c  | TT        At       a  | A  A       Gc       c  | GC        Ta        gt TG        Gc        cg GC       T  |       ta TG        Cg        At CG        Gc        Gc GC        Cg        Tg                         attgtttccgagtggaaacgaacgcgagacaactttttcactcggcagtttttgccgaatcacaattcgaacctagcggatttttctattctgtcaggcgcgagatgcgcgatttcgaatcgcacatcgattattttcgccatcgcacgcctgaattcgtccgcacgcacgttgatcgcttcgattggcggagaatttcgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5610 Predicted hydrolase (HAD superfamily) ... can be seen here     ..................................................................................................................