                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-14.72 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGGACAGCTTCATCTGGGAGTTCATCGCCTATTGCGCCGGCACCGGCGGCTCGATC
CTGATCATCGGCTCGGCCGCGGGCGTTGCCGCGATGGGGCTCGAGCGGATCGAGTTCC
TCTGGTACGCCCGCCGCATCGCCGGCCCCGCGCTCGCCGGCTATCTTGCGGGTGCGGT
GGTGTACATCGCGCAGCACGCGGCGCTGCATTGAgcggttcggaccggctccagattaacgcccggttaacgtaa
ttctttagctccttaagtcagctcttaaggatttcttgccagagatagacaATG

    bll3738 Gene: bll3738     GI: 27378849     BI number: bll3738     GOG: COG0642     Description: two-component sensor histidine kinas             a           g  t           a  t           c  a           c  a           t  c            cg            gc           |  c            gc            cg            cg            at            gt           g  a   T       c  a T  G      t  | A  A      t  | Cg       g  | Gc        gc Tg        cg Cg        gt Gt       |  a C  |      A  a Gt       G  t Gc       T  t       ag Cg       T  c      c  c |  g      A  t      t  t |  a      C  t       gc |  c       Gt        at Gc        Ta        at Cg        Cg        ta A  |       Gc        ta Cg       C  t       cg Gc        Gc        cg At        Gc        ta                         tttcttgccagagatagacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................