                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-15.90 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAGTGGCCAACGCCACCGCCGCCATCGACCCCTCGAGCTCACCGTGCGGCCCATGG
CCGTCGCGGAGCCGCGTGTGGTCATTCATacaaactgtctttccgcggcccgctggggccgagctggaattgctttttc
gcctgaaacattagcagcgcggcaggcctgcgcaacaacgcatcacatggcactatgcccattcgtgcgttgtcgtgaacgggaccgtgggttatttttg
aggggtccggcccccccaagcgccccccaaaacgcgcaattgccggcttttcaggtcaattccATG

    bll3968 Gene: bll3968     GI: 27379079     BI number: bll3968     GOG: COG1529     Description: carbon monoxide dehydrogenase large chai                      tg             t       t  t ac       c  a       gc a  a      a  t       cg c  a       cg        gt gc        gc       |  g cg        gc       |  a gc       t  c       ta ta       a  a       gc |  t      c  t       cg |  c      a  t       tg |  a      c  c      |  g |  c       tg       |  a |  a       at       |  c |  t       cg       |  c cg        gc        tg cg        cg        at gc        at        cg |  a       at        cg gc        cg        cg at        at        gt                         tatttttgaggggtccggcccccccaagcgccccccaaaacgcgcaattgccggcttttcaggtcaattccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1529 Aerobic-type carbon monoxide dehydrogenase, large subunit CoxL/CutL homologs ... can be seen here     ..................................................................................................................