                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=1 nt.   Size=16 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTCGTCCTCCTCCGACAGCGCCACCAGGGCGATGTACTGGGTGTAGGTCAGCCCGA
CCTTGTCCAAGAGGGGCTTGTAGGCACGGCCGAAGGCGAGATTGGCCGAATAGACCGC
AAAGCACAGGAAATTCGACAGCTTTCGGCCTTTGCCGGCGGCTTTGGGGGAACGGGCC
ACgggaacctccgcaattcgtgatctgccaaccgatataaatcgtatccgattaaatcggaagatcttgaccggcggatgcggcgggtttatttaaagg
cgcatccgattagatcggatacgataaATG

    bll4012 Gene: bll4012     GI: 27379123     BI number: bll4012     GOG: COG1764     Description: organic hydroperoxide resistance protei            ga           g  a            cg            ta            at at       |  c t  c       at gc        at cg        tg ta        ta at       |  c at       |  c a  a      |  g       at t  a      a  g      g  g a  |       gc        gc ta        cg        cg at        cg       g  g gc        ta        gc cg        at        cg cg        tg        cg                         gtttatttaaaggcgcatccgattagatcggatacgataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1764 Predicted redox protein, regulator of disulfide bond formation ... can be seen here     ..................................................................................................................