                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAATGCTCCCACGGCGGACCTTGAGCGCAACGTCGCGGACAGCGAAGAAGCCCGCGA
ACTCCTTGGTCAAGCCTTCCGTTTCGAGAATGAACTCATCGGCCAAacagatttccccctgcccgc
gcgacccgcgtggctgtccttgttgcttcggctttcaggaggccttggagccttcccggaacgccgcctccgggcgcggaatatgccggaggtgacgggg
gttaggcaaggcggaaagctgagcagatcaggtctccggctgggatacaaatgctcccttagtcggagatgttttgATG

    bll4036 Gene: bll4036     GI: 27379147     BI number: bll4036     GOG: -------     Description:                       a                     a  a                     c  t             a       a  g           c  g      t  c           g  a       at            at        gc            gc        gc            ta        gc            cg       |  t   a       g  g      |  t g  a      a  t       ta g  a      a  c       cg cg        at        gt gc        gc        gc gt        gc        cg a  g       cg        cg a  a      g  g       ta cg        gc        cg gc        at        ta                         tgttttgATG     ..................................................................................................................