                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -6.44 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGGTCCGGCCACgggccggcgctgaacggcgattcactggactttccgcactatgggccaccggccgggcagatgccaagaccacccg
tggccgccaggccacaagagggaaatattaaccatatgttgagggtgccacggggcagccattttgttgacggatcaaagggatggtagtgagagagtaa
gccggcgtaagagctgtttgtccgaccttggggatccccttccggggattggttggacggccagaactccggccgacattggggacttggtgggattcgt
gcggtagcgcATG

    bll4107 --- bll4106 --- bll4105 --- bll4104 --- pdxA_lrep_1 --- ksgA --- bll4101 Gene: bll4107     GI: 27379218     BI number: bll4107     GOG: COG0795     Description: - Gene: bll4106     GI: 27379217     BI number: bll4106     GOG: COG0795     Description: - Gene: bll4105     GI: 27379216     BI number: bll4105     GOG: COG1452     Description: - Gene: bll4104     GI: 27379215     BI number: bll4104     GOG: COG0760     Description: - Gene: pdxA_lrep_1     GI: 27379214     BI number: blr3887     GOG: COG1995     Description: pyridoxal phosphate biosynthesis protein Gene: ksgA     GI: 27379213     BI number: bll4102     GOG: COG0030     Description: rRNA-adenine N6,N6-dimethyltransferase Gene: bll4101     GI: 27379212     BI number: bll4101     GOG: COG1064     Description:             t           a  a           c  t            cg            at            at            tg            ta           a  g           t  g           a  |           a  |           a  |           g  |           g  |           g  |           a  | cc       g  | g  a      a  | cg       a  | cg        cg gc        at gc       c  | ta        cg        cg gc        gc       a  g |  a       gc        cg |  a      a  a       cg |  g      c  |       gc |  a      c  |       ta cg        gc       g  g cg        cg        gc cg        cg        gc                         attttgttgacggatcaaagggatggtagtgagagagtaagccggcgtaagagctgtttgtccgaccttggggatccccttccggggattggttggacggccagaactccggccgacattggggacttggtgggattcgtgcggtagcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0795 Predicted permeases ... can be seen here [R] COG0795 Predicted permeases ... can be seen here [M] COG1452 Organic solvent tolerance protein OstA ... can be seen here [O] COG0760 Parvulin-like peptidyl-prolyl isomerase ... can be seen here [H] COG1995 Pyridoxal phosphate biosynthesis protein ... can be seen here [J] COG0030 Dimethyladenosine transferase (rRNA methylation) ... can be seen here [R] COG1064 Zn-dependent alcohol dehydrogenases ... can be seen here     ..................................................................................................................