                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-18.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCATGGTCGCGAACGCGATGGACCCAGCCCGAGAGGCGGATCGTCTCGCCGATGT
TGCTCTCGCGGAGCGCGCCGCATGTATGTGACCGGTAGCGATGCATggtcgtcccaaattgatgtc
tgaggaagcgaatcggacgactgaggtggccggtccgaaagttgcggcagggtttacccgacgaggcccaaggcggcaaccaagggaacggcctgtttgg
ggcccggaaggcccatttttggccgatctgggctcaagcctttgccatcaggcgttccccgcctatctttacctccATG

    bll4142 Gene: bll4142     GI: 27379253     BI number: bll4142     GOG: COG0397     Description: cg c  a c  c        a a  g      a  g ta        cg tg        cg tg       |  a gc       |  a gc       a  c gc       a  g |  a       cg |  a       gc a  g       gc cg       |  t gc        cg g  g       gt cg        gt gc        at ta       a  g ta        cg        ga gc        cg       g  a a  c       cg        cg a  a       gc        cg a  a       gc       c  | g  |      a  |       gc cg        gc        gc cg        cg        gc                         atttttggccgatctgggctcaagcctttgccatcaggcgttccccgcctatctttacctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0397 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................