                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:9 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGAACAATGGTCTGAGTGAGGGATCTGCAAAGATCTATCAATTCCCCGCCGGGGGC
CGCGCGGCTCTCGGAGGTCGCCGCTACGGTGAGGCCCGCCTTCCTGCCGACCGTCTCT
CGCTTCCTGTGAACGAGACGATCTGCAGCGGAAGCTGGTACCATCAGGAGGCCGTCGA
CGAAGCCAAGCCGAAATGGGATCGCTAAtgcctgcgtttggttcaatcccgcgacgctccctggagcgaccggcagcag
tttgaagagggtcgaaacaatgaggtttcgaccctttttgattcttgATG

    bll4166 --- bll4165 --- bll4164 Gene: bll4166     GI: 27379277     BI number: bll4166     GOG: -------     Description: - Gene: bll4165     GI: 27379276     BI number: bll4165     GOG: COG2365     Description: - Gene: bll4164     GI: 27379275     BI number: bll4164     GOG: COG1028     Description:             c           a  c           g  g            cg            gc           a  a           g  g            gc            ta            cg           |  t           |  t       tg           |  t      a  a           |  g      a  g           |  a       cg           c  a       at            cg        at ct        ta        at c  g       cg        gc cg       g  g       cg ta        cg        ta cg        at        gc gc        gc        gc cg        cg        gc                         tttttgattcttgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2365 Protein tyrosine/serine phosphatase ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................