                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCACCAGGATCGTGTAGCGCGGCGTGCGCACGACGAACGTCTGATAGGTGATGACCA
TCATGCCGCGCGCGGCGTCGAACACCTCCGGCTCCATGGTCGGCAGATGGCGCCTGAA
TACGCCCTCATCGTAAGCCGGGAAAAAGTCCTGAGGCCGCCGCCAGGGCCCTTCCCGC
TCGATCACCGCGTCGATGGTGATGTCGCCGATCCGGAGTTGCTTCATggttgctttgctcccttt
tttgcagagagcgtagcggtcagcacaagaccgttcaagccgcgcaacgcgtccggcacctATG

    bll4185 Gene: bll4185     GI: 27379296     BI number: bll4185     GOG: COG0584     Description: TG A  G GT CG TA GT CG |  T        T GC       A  g CG       C  g C  C      T  t A  C      T  t CG        Cg TA        Gc AT       |  t GC       |  t |  C      T  t |  G       Tg CG        Gc TA        At CG        Gc GT        Gc             cttttttgcagagagcgtagcggtcagcacaagaccgttcaagccgcgcaacgcgtccggcacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0584 Glycerophosphoryl diester phosphodiesterase ... can be seen here     ..................................................................................................................