                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=22 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-17.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGTGCTGGTCCGCGAGCAGATCGTGATCATCGATCCGAATACCTATGAGATCGTCGC
GATCCTCGACGTCTAAggccggatgacggcaacctcaggggcgggcagcgatgcccgcccctttgcgttcggccgacagccatgcttt
tgactggttaacaagcaatttccgtagcttccgcacaggtttttgcaccccggatgaggtgcctgaaggcctctgggaggtccttcaaggcttcccctag
ggcgctttgttacctataaccccgccacgccgaaacacctcttacgggattggaATG

    aroQ --- accB --- accC Gene: aroQ     GI: 27379403     BI number: bll4292     GOG: COG0757     Description: 3-dehydroquinate dehydratase Gene: accB     GI: 27379402     BI number: bll4291     GOG: COG0511     Description: biotin carboxyl carrier protein subunit of acetyl-CoA carboxylasen Gene: accC     GI: 27379401     BI number: bll4290     GOG: COG0439     Description: biotin carboxylase subunit of acetyl-CoA carboxylase ga g  t c  g c  a cg cg at cg                  tc gc                 t  a |  c                c  a |  t                 cg tg                  tg ta                  gc ta         g        gt tg       t  g       at tg        cg        gc gc        ta        gc gc        cg        gc at        cg       |  c c  c      |  t      t  t at        gc       c  a cg        gc        tg g  |       at        cg cg        at        cg cg        gc        gc                         gctttgttacctataaccccgccacgccgaaacacctcttacgggattggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0757 3-dehydroquinate dehydratase II ... can be seen here [I] COG0511 Biotin carboxyl carrier protein ... can be seen here [I] COG0439 Biotin carboxylase ... can be seen here     ..................................................................................................................