Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-18.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.77 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-21.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCGGCAAGCAGATCGTGATTGGCGCCATCGGTCTCGAAGGCCTCAAGGAGAAGAT
CGGCGTTGCCCGCTGCGGCAAGGCAACCTGCTGAtcacgcgcttcacaactcacgcacgcaacgaggccggctga
aaagccggcctttttgctgcgccaaacaatggcgcgatccggcacaatcattcatccggcgttcaacaaacaaatgccgcggaaccgccgatgttccgga
acaaccgatatctcctttcgttgttggcgcgggcaatgacgcaaataaacacgtgaggagaatctaaATG

    bll4293


Gene: bll4293     GI: 27379404     BI number: bll4293     GOG: NOG40041     Description:


 GC
T  G
 CG
 GC
|  A
C  A
 CG
 CG
 GC        cg
 TA       a  c
 TA       c  a
 GC       t  c
|  C      c  g
|  T      a  c
 CG       a  a
 GC       c  a
 GT       a  c
 CG        cg
 TA        ta
 At        tg
 Gc        cg        aa
|  a       gc       g  a
|  c      |  c       ta
|  g      |  g       cg
A  c       cg        gc
A  g       gc        gc
 Gc       c  |       cg
 At        at        cg
 Gt        cg        gc
 Gc        ta        gc
                        tttttgctgcgccaaacaatggcgcgatccggcacaatcattcatccggcgttcaacaaacaaatgccgcggaaccgccgatgttccggaacaaccgatatctcctttcgttgttggcgcgggcaatgacgcaaataaacacgtgaggagaatctaaATG
    ..................................................................................................................