Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTACTATCCCGAACCGATGCAGATGACGTTGTAGccggtgataccaagcccgggtcgcgcatgtgcggcccgg
gccgttcgcttgatctgaccgacagaggggaatgatccctgaccggttcctgtcgcgtcgcaacgacacttctggagcatttttcggcaaggcaggcccg
ttccaggcaagagctcgcctcactgctcggataagagtcccctcgcatcactttcgtcgacgagagctcgtgacgcccctttggcctgacgccgctcacg
ctcgcaaaatgctcaggagacatgccATG

    bll4366


Gene: bll4366     GI: 27379477     BI number: bll4366     GOG: COG0702     Description:


           tg
          a  a
           at
           gc
           gc
           gc
           gt
          |  g       cg
  c       |  a      t  c
c  g      |  c      g  a
a  a      |  c      c  a
 gc       |  g       gc
 ta       |  g       cg
 cg       |  t       ta
 ta       |  t       gc
a  |      a  c       ta
g  |       gc       |  c
t  |       at       |  t
 tg        cg       |  t
 cg        at       |  c
g  g       gc       |  t
 cg        cg        cg
 ta       |  c       cg
 ta        cg        ta
 gt        at        tg
 cg        gc        gc
                        atttttcggcaaggcaggcccgttccaggcaagagctcgcctcactgctcggataagagtcccctcgcatcactttcgtcgacgagagctcgtgacgcccctttggcctgacgccgctcacgctcgcaaaatgctcaggagacatgccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[MG] COG0702 Predicted nucleoside-diphosphate-sugar epimerases ... can be seen here

    ..................................................................................................................