                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.84 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-13.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgacgcgaaaagattcttgcagtcctgccgcgtcgggcggtcaggagacacaatcgcgacacaatcattgattgcattgcggcaccgcgtggctggatcg
tgctgacgaagcaacgtcggcaaccggtgtcttttgtcgcgcgccggaattgcatcgcgcactttgacaagccgcgctaacccgcaaatcaattccactt
gctagcttgtctgaaccggcgcagcattccaccgctggcctcaggccgaacacaacgcgcgagacaatcgcgcagctcaaaagaagaatggaggaaacga
ATG

    bll4367 Gene: bll4367     GI: 27379478     BI number: bll4367     GOG: COG0491     Description:   t a  t cg ta at at cg a  c c  a at gt cg gc        gc        gc cg       g  t      a  a tg       t  g      a  a a  c      g  g       gc a  |      c  a       cg c  |      g  t       at a  |      c  c       gc c  |       cg        tg a  |       at        cg g  |       cg        gc a  |       gc        ta g  |       gt       g  a g  |       cg       c  | a  |      |  a      t  | c  |       gc       a  | ta        tg        gc gc        ta        gc gc       a  a       tg cg        cg        cg gc        gc        gt                         gtcttttgtcgcgcgccggaattgcatcgcgcactttgacaagccgcgctaacccgcaaatcaattccacttgctagcttgtctgaaccggcgcagcattccaccgctggcctcaggccgaacacaacgcgcgagacaatcgcgcagctcaaaagaagaatggaggaaacgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................