                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-15.10 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-24.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAACCTGCTGTTCGGCGGCGCCACCCTGATCGGCATGGCGCTGGCGGCACGCAACAG
CAACACCTGAggggtctcgtcgcccgccaagccgattggggggtgacaaccagccaatggcacgctatatcgcctgccatgatcaccgttgcc
accagctatttttggtactttagctacgacagctcgctggcggcaggaggatcgcgctcaatctgaaatattgaagcaaacgtccgaacagccgccagac
ctggcggcttttttattggccggcaggttcaaacaagcaggagcccgccGTG

    aroG Gene: aroG     GI: 27379500     BI number: bll4389     GOG: COG0722     Description: phospho-2-dehydro-3-deoxyheptonate aldolas             a           g  a           t  a           c  t            ta            at            at            cg           |  a            ta            cg            gc tc       |  a c  g      |  a gc       c  a at        gc cg        cg a  g      t  | g  c       at c  |       gc a  |       gc tg       |  g cg       a  a gc       g  a a  a      g  c       ac t  g      a  a      g  c tg        cg        at ta        gc        cg cg        gc        cg a  g       cg        gc ta        gc        cg gt        gc        cg gc        ta        gc tg        cg        at                         tttttattggccggcaggttcaaacaagcaggagcccgccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0722 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here     ..................................................................................................................