Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCACTGGTAGggccttttccataggaacaagccctcgccgcgcacgttcactcctcgacaagatgattggaggaggacgcaatgggacgag
gattgttgctgtggatgctgggcgtgccgatcccggtgatccttctgctgtggctgttcttcggccactgacgagctggttcaacctgcaatgaaagctc
tgcccatggcggagctttttgcatgaggggcgcgccgcaaacgccgtcgtccggcacaggaaattccgctatcacccgcacaattgaaaacgccgcggga
gaagcttcATG

    bll4398


Gene: bll4398     GI: 27379509     BI number: bll4398     GOG: COG0625     Description: glutathione S-transferase like protei


  c
t  t
t  t
 gc
 tg
 cg
 gc        tg
 gc       c  c
 ta       c  a
 gc       a  a
|  t       at
|  g       cg
|  a       ta
|  c       ta
|  g      g  |
 ta       g  |
 cg        ta
 gc        cg
t  t       gc
c  |       at
t  |       gc
t  |      c  t        a
 cg       a  |      c  t
 cg       g  |       cg
t  t      t  |       cg
 at       c  |       gc
 gc       a  |       tg
|  a      c  |       cg
 ta        cg        ta
 gc        gc        cg
 gc        gc        gc
                        tttttgcatgaggggcgcgccgcaaacgccgtcgtccggcacaggaaattccgctatcacccgcacaattgaaaacgccgcgggagaagcttcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0625 Glutathione S-transferase ... can be seen here

    ..................................................................................................................