                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAATATCGCCTATTTTCAAGGGCTTGGAGCCTGATCCTGCCGAGCCGGTCACAGTG
GTCTCATTCACTCGCAGGGCCTCATCGCACCTGCCATGACCTATCTTGCGCACAATTC
TTGTGCAGTCAAGCGTCATgcctacagtttagacagttctgcaaatctttcaagtgcagtgcagcaaattgctgtttcccacaatc
cagggaaaccccctttttttgcgggcctgccgtgctagaggcatgccggcaatcacccacttccgactctttcattagcaactgagtatttgagtcctAT
G

    bll4485 --- bll4484 Gene: bll4485     GI: 27379596     BI number: bll4485     GOG: COG0245,COG1211     Description: - Gene: bll4484     GI: 27379595     BI number: bll4484     GOG: COG1546     Description:             a tc       a  t t  a      a  t ta        cg cg        gc        at |  t       at       a  c |  g       cg       c  c t  c       gt       a  a a  a      t  t       cg a  g      g  t       cg at       a  c       cg cg       c  c       ta gc        gc        ta ta        ta        ta cg        gc        gc                         cccctttttttgcgggcctgccgtgctagaggcatgccggcaatcacccacttccgactctttcattagcaactgagtatttgagtcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0245 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase ... can be seen here [I] COG1211 4-diphosphocytidyl-2-methyl-D-erithritol synthase ... can be seen here [R] COG1546 Uncharacterized protein (competence- and mitomycin-induced) ... can be seen here     ..................................................................................................................