                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-25.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGACGCCGAAGAAGCTGCGCATCCGACCTGAccgatgcacgctcggcgggcatctcgcgaagcgcccgcttgac
aagccctgcccttcggctgtagggacgcggcccatgatcaattctcggaccaaccgccgcgcagctttccgtcgtcgcacccgcgacgatgatgggttgc
gccatgtccgacgacgccgctgaagcactgaattcagccagttttcgagaaggccgcacccgcaaagtgcggccttcttgctttttgcgtccattttcca
cccgcccctcgataggagttcgacATG

    argD_lrep_1 Gene: argD_lrep_1     GI: 27379693     BI number: blr1098     GOG: COG4992     Description: acetylornithine aminotransferas tc t  a a  g a  c        c gc       g  a ta       c  a cg       c  a at        cg c  |       at gt        cg at        gc at        cg gc        cg tg        gc |  a       gc |  g       at c  a       at g  a       gc cg        at cg        gt gc        cg             ctttttgcgtccattttccacccgcccctcgataggagttcgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4992 Ornithine/acetylornithine aminotransferase ... can be seen here     ..................................................................................................................