                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGACCAGGGCGGCCAGGATGTTTTCGTTCATATCAGCGCAGTTGAACGCGCCGGCAT
GAGCACCCTCAACGAGGGCCAGAAGGTTTCCTTCGAAATCGTCGCGGACCGCCGGACC
GGCAAGTCTGCTGCGGAAAATCTGCGCGCCGTCTAGgctaccgcaatcggtactatgttgctttgaccacgga
tgtactggcagagcttctggttctctcgacccgcgactggtttaccggccgcgggtttttttgcatcggttgcgggtcggcccgcccatcgaaacagctg
aggtcgcgagcGTG

    bll4594 Gene: bll4594     GI: 27379705     BI number: bll4594     GOG: COG1398     Description: delta 9 acyl-lipid fatty acid desaturas             c           t  t           t  g            cg            gt            at   t        gc        tt a  g       at       t  a g  t      c  |       gc g  a       gc        gc c  c       gt        tg at       t  c       cg cg       c  g      a  c cg       a  |       gc a  |       ta        cg gc        gc        gc ta       t  |       cg tg       a  |       cg ta        gc        cg cg        gc        at gc        cg        gt                         tttttgcatcggttgcgggtcggcccgcccatcgaaacagctgaggtcgcgagcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1398 Fatty-acid desaturase ... can be seen here     ..................................................................................................................