                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCACGCGCACCGCGTCTGCAAGGAGAGACGCGCCGCGCAAGATCTTCTCGCGGGCTG
CTGAATGGAACAGGACTTGTTTGTGTGCCATttcaatgcctcaaggtgtcgtagttggcgttaccctgcgcgccact
tttgtacgactgcgtccggctcagtttgatcttggtcaaccagaggcggaggttattgagccggccggtgaagaagtggctgatcgggacttgacctagc
gcaatccgccaaaggcatcgcggcggtatttctgaacccaatagttgagaggaggggatcgccagATG

    bll4634 Gene: bll4634     GI: 27379745     BI number: bll4634     GOG: COG0845     Description:   T T  G C  T AT GT G  G AT        ca CG       t  a        t AT        cg       g  t A  G       cg       c  a GC        gt        gc GC        tg        gc TA        at       t  | AT       |  c      t  | At       a  g       gc Gt       c  t       at T  c      t  a       tg C  a      t  g       gc G  a      T  t       cg T  t       At       t  | Cg        Cg        gc Gc        Cg        tg Gc        Gc        gc Gt        Tg        gc                         acttttgtacgactgcgtccggctcagtttgatcttggtcaaccagaggcggaggttattgagccggccggtgaagaagtggctgatcgggacttgacctagcgcaatccgccaaaggcatcgcggcggtatttctgaacccaatagttgagaggaggggatcgccagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here     ..................................................................................................................