                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCCGGACGAAGTAGagacggctcccggccggcggccacaatcccgccgaaaggccattgacggacgcaagactctcccccataag
tcgccgccatgttcacgaccaccaaacgcacgaccaaaaccaccacggccttcggggcccggggaggcgtgcgcgcgtagtcgtcgactgaaacgcatca
gctctaccgaagccccgccctcgatggtccggggcttttttgttgtctaaagctcacagcatgatccggaaaagtggaatccggttttccgacgagatca
tgctcaacttgaATG

    asd_lrep_1 Gene: asd_lrep_1     GI: 27379798     BI number: bll0501     GOG: COG0136     Description: aspartate-semialdehyde dehydrogenas            cg           a  c           a  a            at            gc            ta            cg           |  c            at         g            gc       c  a cg       c  t      t  t g  c       ta        cg tg        gc        cg gc       |  c      |  t cg       |  g      c  c gt       |  a       gc |  a      c  a       cg g  g       tg        cg at        gc        cg gc       a  c       cg g  g      t  c       gc gt        gc        at gc        cg        at cg        gc        gt                         tttgttgtctaaagctcacagcatgatccggaaaagtggaatccggttttccgacgagatcatgctcaacttgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0136 Aspartate-semialdehyde dehydrogenase ... can be seen here     ..................................................................................................................