                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcctgcgtccaccacgtcccctcccgcgtgtcgtgacgatcgcgatacgcccctcggaccgggctgggatggccgaaacatgcgacatttccgaattcgc
gtaaagcgaattgttttgatcggaacggattgaccccggccttgtgtgttttgcccgtcgggcaacgcaagggatggcgtggatgcgggagcgatccccg
ccacagccgtgccacgaaccggtctccccacggcccgaaaatgcgctacgatgatcgcagcgcgcctcaagtcgcgcagctccaggagtgaggaaacggt
ATG

    bll4707 --- bll4706 Gene: bll4707     GI: 27379818     BI number: bll4707     GOG: -------     Description: - Gene: bll4706     GI: 27379817     BI number: bll4706     GOG: COG3391     Description: cg c  g a  g gc gt cg tg cg |  a c  t cg cg gc |  c       cc |  g      t  g |  a       ta c  a       ta         a a  a       at       t  a t  c      c  |      g  a a  a       at        cg gt        gc        gc cg        cg        cg gc        gc        ta cg        tg        ta ta        at        at                         tgttttgatcggaacggattgaccccggccttgtgtgttttgcccgtcgggcaacgcaagggatggcgtggatgcgggagcgatccccgccacagccgtgccacgaaccggtctccccacggcccgaaaatgcgctacgatgatcgcagcgcgcctcaagtcgcgcagctccaggagtgaggaaacggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3391 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................