                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-36.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-24.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCCGCCCCGCCCAGCGGCCCCGCCGCCGGCGGCCAAGAAGTGCCCGCCGAACCAGCC
CAAGTGCTAGgcaagcgctagtccagcgccagagcctggcgcggtctttacggaaggggggccattcgcgggcgaaaccgcccgcgaatggcc
cttatttccttgcttctggccgaaatcgcgctatatagcgcgccatctcacacggaagcatggctcacaaggccgtccggtggcagccggggcgcaacgc
tccgttttgctcacacgcttccggaggaaccaaccggagaattataacaATG

    bll4861 Gene: bll4861     GI: 27379972     BI number: bll4861     GOG: COG0052     Description: 30S ribosomal protein S   t g  c a  c ta cg gc         g cg       g  a gc       c  a |  c      a  g |  a       tg        aa a  g       tg       a  c a  a       tg        gc cg        cg        cg gc        tg        gc Gc        gc        gc At        gc        gc Tg       |  a       cg Cg       |  t       gc Gc       c  t       cg Tg        gc        ta Gc        cg        ta A  |      g  |       at A  |       gc        cg C  |       tg        cg Cg        cg        gc Cg        cg        gc Gt        gc        gc                         ttatttccttgcttctggccgaaatcgcgctatatagcgcgccatctcacacggaagcatggctcacaaggccgtccggtggcagccggggcgcaacgctccgttttgctcacacgcttccggaggaaccaaccggagaattataacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0052 Ribosomal protein S2 ... can be seen here     ..................................................................................................................