                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-25.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGCGGCGGCATCAAGACGGTGCTGATCCCCGAGGACAACGCCAAGGATCTCACGGA
GATTTCCGATGCGATCAAGGGCGGCATGGAGATCATCCCGGTCTCCCGTCTCGACGAC
GTCGTCGCCAGGGCGCTGGTGAAGAAACCGGTGCCGATCGTCTGGGAAGAGGACACCA
AGGTGACGGTGAAGCCGGACGGCGACGAAGCCGCTGGCGGCCTGACCGCTCACTGAgc
tccagcgaaagatgataaaacggcgccttcgggcgccgtttttgctttgatgcaagggaacgagggcgATG

    bll4941 Gene: bll4941     GI: 27380052     BI number: bll4941     GOG: COG3791     Description: CG A  A G  A CG GC        cc GC       t  a CG        cg A  |       gc GC       |  g GT       A  a CG       G  a CG        Ta GC        Cg |  G      |  a |  G       At |  C       Cg A  C       Ta A  T      C  t G  G      G  a TA       C  a       tc GC       C  a      t  g GC       A  a       cg CG        Gc        cg |  C       Tg        gc AT        Cg        cg GC       |  c       gc TA        Cg        gc GC        Gc        cg                         tttttgctttgatgcaagggaacgagggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3791 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................