                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtatactgcccaccaattgctactaggacgagtgttgtagggcgtagtgtcatgttgtttgtttcaggattgattttactccccgcgggatgatcggcgg
cccgcgccggataaagtgcgccgaccgcattttctccggatacatctatcggttctgcgcgagcccggtcggcacgcgaatggttggttagattcattgc
tttgattgacggcttgttttttcgctgcgcgggttcacgtccgggaggggacgatgatcaggccaggaagcatcggttgtttcggtaaattcattgatga
ATG

    bll5043 --- bll5042 --- bll5041 --- bll5040 Gene: bll5043     GI: 27380154     BI number: bll5043     GOG: COG2114,COG3899     Description: - Gene: bll5042     GI: 27380153     BI number: bll5042     GOG: -------     Description: - Gene: bll5041     GI: 27380152     BI number: bll5041     GOG: -------     Description: - Gene: bll5040     GI: 27380151     BI number: bll5040     GOG: COG2837     Description:            at   c       g  a t  g      g  a a  g      c  a gc        cg tg        gt a  g       cg gc        gc gc       c  | gc       c  | cg        cg gc        gc cg        gc |  c       cg c  c      |  a cg        gc cg        gc ta        cg             cattttctccggatacatctatcggttctgcgcgagcccggtcggcacgcgaatggttggttagattcattgctttgattgacggcttgttttttcgctgcgcgggttcacgtccgggaggggacgatgatcaggccaggaagcatcggttgtttcggtaaattcattgatgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2114 Adenylate cyclase, family 3 (some proteins contain HAMP domain) ... can be seen here [R] COG3899 Predicted ATPase ... can be seen here [P] COG2837 Predicted iron-dependent peroxidase ... can be seen here     ..................................................................................................................