                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGGTTTCCCGAAATCGAACAAGTTCGGCCGGGGGATCGAGTAGgggctgcgactgcctgctacaac
gccgtgtcatgccccgcgaaggcggggcatccagtacgccgcagcctctcggccgaaccacaatcgtctctggaatactggatcgcccgccttcgcgggc
gatgacaccgacggtgtagcccgcaaacgcttggcagatagccgtgagcgcatacgtgcctccgttgatcgggcacgaacattgctttttcctggcgact
gcaaacgacaagtcaaaaggcaaataagcaacaATG

    bll5056 --- bll5055 Gene: bll5056     GI: 27380167     BI number: bll5056     GOG: COG0747     Description: - Gene: bll5055     GI: 27380166     BI number: bll5055     GOG: COG2303     Description:   a g  t a  a        t cg       t  g gc       g  a gc       c  t |  g      c  c |  t       tg tg        cg ta        cg cg        gc gc        ta cg        gc a  c       cg a  a      |  a a  t      |  a c  a      |  c gc       a  a cg       t  t c  t       at cg        cg gc        gc             tttttcctggcgactgcaaacgacaagtcaaaaggcaaataagcaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [E] COG2303 Choline dehydrogenase and related flavoproteins ... can be seen here     ..................................................................................................................