                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAAGCGTCATCGCGTTCAGGACACGGTCGGCGGGAATGCCGCCCTTCCGGGCCATC
TCGACGCCCCAGTGCATGTGGTCGAGCTCCGGGATCGAGTGCGCGTCCGGATTGATGC
TGAGCATGCAGCCGAAGTCGAGGGCGGCCTGGTGCCAGCGCCAATCCAGATCGAGGCG
CCATGGGTGGGCGTTGATGCTGCACCGCAGCGGTCTCGACGATTGCCGACCATCCGTA
TTTGATGTCAAATTGATCCTTGTTCTGGGTCGAGCTTTTTTGATGTCCATtttcagggaggaa
ttgcgATG

    bll5238 Gene: bll5238     GI: 27380349     BI number: bll5238     GOG: -------     Description: CG C  C A  A CG GC TG CG GT T  C AT         A GC       T  T TG       G  T TA       C  T GC        CG CG        TA |  A       AT |  T      C  | |  T       CG |  G       AT |  C       GC |  C      C  A        T |  G      C  |      G  T G  A      G  |      T  C GC        TA       T  T GC        TA        CG TA        AT        CG GT        GT        TG GC        CG        AT GC       |  A       GC TG        AT        TG AT        GC        TA                         GCTTTTTTGATGTCCATtttcagggaggaattgcgATG     ..................................................................................................................