                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:195 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=55 nt.     Delta G=-18.70 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagcgtgatagccattgctcaaaggggatagattgtcggaaaggcccgcggccagcctgaacgcggaaaagtccggtcagctaacggcggggctggctat
ttgttccgaagattggaacgatgcgtctgcggacgcgtctttgcgaggcgccataacgctcattcataaaactccgttttcgaagaggctaaatcttgaa
gctctttgtctgccaggcctgcggcaacgtcctctatttcgagaaccgcgcctgtggacgttgcggtcaccgcgtcgccttcctcccggagagggagacg
ATG

    bll5268 Gene: bll5268     GI: 27380379     BI number: bll5268     GOG: COG4307     Description:             c           g  c            at            cg           c  a           g  a            gc            cg            gc            cg            cg           c  a           g  a           g  a           a  a           a  g            at            gc   g        gc        gg c  c       cg       c  c cg        tg       a  g cg       |  t      a  g gc        gc        tg gc        ta        cg a  a       tg        gc a  g      a  |       at a  |       gc        cg gc        at        tg gc        ta        gc                         tatttgttccgaagattggaacgatgcgtctgcggacgcgtctttgcgaggcgccataacgctcattcataaaactccgttttcgaagaggctaaatcttgaagctctttgtctgccaggcctgcggcaacgtcctctatttcgagaaccgcgcctgtggacgttgcggtcaccgcgtcgccttcctcccggagagggagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4307 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................